trim_galore 0.6.7
trim_galore-0.6.7
For all high throughput sequencing applications, we would recommend performing some quality control on the data, as it can often straight away point you towards the next steps that need to be taken (e.g. with FastQC). Thorough quality control and taking appropriate steps to remove problems is vital for the analysis of almost all sequencing applications. This is even more critical for the proper analysis of RRBS libraries since they are susceptible to a variety of errors or biases that one could probably get away with in other sequencing applications. In our brief guide to RRBS we discuss the following points:
- poor qualities – affect mapping, may lead to incorrect methylation calls and/or mis-mapping
- adapter contamination – may lead to low mapping efficiencies, or, if mapped, may result in incorrect methylation calls and/or mis-mapping
- positions filled in during end-repair will infer the methylation state of the cytosine used for the fill-in reaction but not of the true genomic cytosine
- paired-end RRBS libraries (especially with long read length) yield redundant methylation information if the read pairs overlap
- RRBS libraries with long read lengths suffer more from all of the above due to the short size- selected fragment size
Poor base call qualities or adapter contamination are however just as relevant for ‘normal’, i.e. non-RRBS, libraries.
Adaptive quality and adapter trimming with Trim Galore
We have tried to implement a method to rid RRBS libraries (or other kinds of sequencing datasets) of potential problems in one convenient process. For this we have developed a wrapper script (trim_galore) that makes use of the publicly available adapter trimming tool Cutadapt and FastQC for optional quality control once the trimming process has completed.
Even though Trim Galore works for any (base space) high throughput dataset (e.g. downloaded from the SRA) this section describes its use mainly with respect to RRBS libraries.
Full list of options for Trim galore!
USAGE: trim_galore [options] <filename(s)>
General options:
-
-h/--help- Print this help message and exits.
-
-v/--version- Print the version information and exits.
-
-q/--quality <INT>- Trim low-quality ends from reads in addition to adapter removal. For RRBS samples, quality trimming will be performed first, and adapter trimming is carried in a second round. Other files are quality and adapter trimmed in a single pass. The algorithm is the same as the one used by BWA (Subtract INT from all qualities; compute partial sums from all indices to the end of the sequence; cut sequence at the index at which the sum is minimal).
- Default Phred score:
20
-
--phred33- Instructs Cutadapt to use
ASCII+33quality scores as Phred scores (Sanger/Illumina 1.9+ encoding) for quality trimming. - Default:
ON
- Instructs Cutadapt to use
-
--phred64- Instructs Cutadapt to use
ASCII+64quality scores as Phred scores (Illumina 1.5 encoding) for quality trimming.
- Instructs Cutadapt to use
-
--fastqc- Run FastQC in the default mode on the FastQ file once trimming is complete.
-
--fastqc_args "<ARGS>"- Passes extra arguments to FastQC. If more than one argument is to be passed to FastQC they must be in the form
arg1 arg2 [..]. - An example would be:
--fastqc_args "--nogroup --outdir /home/". - Passing extra arguments will automatically invoke FastQC, so
--fastqcdoes not have to be specified separately.
- Passes extra arguments to FastQC. If more than one argument is to be passed to FastQC they must be in the form
-
-a/--adapter <STRING>- Adapter sequence to be trimmed. If not specified explicitly, Trim Galore will try to auto-detect whether the Illumina universal, Nextera transposase or Illumina small RNA adapter sequence was used. Also see
--illumina,--nexteraand--small_rna. - If no adapter can be detected within the first 1 million sequences of the first file specified Trim Galore defaults to
--illumina. A single base may also be given as e.g.-a A{10}, to be expanded to-a AAAAAAAAAA.
- Adapter sequence to be trimmed. If not specified explicitly, Trim Galore will try to auto-detect whether the Illumina universal, Nextera transposase or Illumina small RNA adapter sequence was used. Also see
-
-a2/--adapter2 <STRING>- Optional adapter sequence to be trimmed off read 2 of paired-end files. This option requires
--pairedto be specified as well. If the libraries to be trimmed are smallRNA then a2 will be set to the Illumina small RNA 5' adapter automatically (GATCGTCGGACT). A single base may also be given as e.g.-a2 A{10}, to be expanded to-a2 AAAAAAAAAA.
- Optional adapter sequence to be trimmed off read 2 of paired-end files. This option requires
-
--illumina- Adapter sequence to be trimmed is the first 13bp of the Illumina universal adapter
AGATCGGAAGAGCinstead of the default auto-detection of adapter sequence.
- Adapter sequence to be trimmed is the first 13bp of the Illumina universal adapter
-
--nextera- Adapter sequence to be trimmed is the first 12bp of the Nextera adapter
CTGTCTCTTATAinstead of the default auto-detection of adapter sequence.
- Adapter sequence to be trimmed is the first 12bp of the Nextera adapter
-
--small_rna- Adapter sequence to be trimmed is the first 12bp of the Illumina Small RNA 3' Adapter
TGGAATTCTCGGinstead of the default auto-detection of adapter sequence. - Selecting to trim smallRNA adapters will also lower the
--lengthvalue to 18bp. If the smallRNA libraries are paired-end then-a2will be set to the Illumina small RNA 5' adapter automatically (GATCGTCGGACT) unless-a 2had been defined explicitly.
- Adapter sequence to be trimmed is the first 12bp of the Illumina Small RNA 3' Adapter
-
--max_length <INT>- Discard reads that are longer than
bp after trimming. This is only advised for smallRNA sequencing to remove non-small RNA sequences.
- Discard reads that are longer than
-
--stringency <INT>- Overlap with adapter sequence required to trim a sequence.
- Defaults to a very stringent setting of
1, i.e. even a single base pair of overlapping sequence will be trimmed of the 3' end of any read.
-
-e <ERROR RATE>- Maximum allowed error rate (no. of errors divided by the length of the matching region)
- Default:
0.1
-
--gzip- Compress the output file with
gzip. - If the input files are gzip-compressed the output files will be automatically gzip compressed as well.
- Compress the output file with
-
--dont_gzip- Output files won’t be compressed with gzip. This overrides
--gzip.
- Output files won’t be compressed with gzip. This overrides
-
--length <INT>- Discard reads that became shorter than length INT because of either quality or adapter trimming. A value of
0effectively disables this behaviour. - Default:
20 bp. - For paired-end files, both reads of a read-pair need to be longer than
bp to be printed out to validated paired-end files (see option --paired). If only one read became too short there is the possibility of keeping such unpaired single-end reads (see--retain_unpaired). - Default pair-cutoff:
20 bp.
- Discard reads that became shorter than length INT because of either quality or adapter trimming. A value of
-
--max_n COUNT- The total number of
Ns(as integer) a read may contain before it will be removed altogether. - In a paired-end setting, either read exceeding this limit will result in the entire pair being removed from the trimmed output files.
- The total number of
-
--trim-n- Removes
Nsfrom either side of the read. - This option does currently not work in RRBS mode.
- Removes
-
-o/--output_dir <DIR>- If specified all output will be written to this directory instead of the current directory. If the directory doesn’t exist it will be created for you.
-
--no_report_file- If specified no report file will be generated.
-
--suppress_warn- If specified any output to
STDOUTorSTDERRwill be suppressed.
- If specified any output to
-
--clip_R1 <int>- Instructs Trim Galore to remove
bp from the 5' end of read 1 (or single-end reads). This may be useful if the qualities were very poor, or if there is some sort of unwanted bias at the 5' end. - Default:
OFF
- Instructs Trim Galore to remove
-
--clip_R2 <int>- Instructs Trim Galore to remove
bp from the 5' end of read 2 (paired-end reads only). This may be useful if the qualities were very poor, or if there is some sort of unwanted bias at the 5' end. - For paired-end BS-Seq, it is recommended to remove the first few bp because the end-repair reaction may introduce a bias towards low methylation. Please refer to the M-bias plot section in the Bismark User Guide for some examples.
- Default:
OFF
- Instructs Trim Galore to remove
-
--three_prime_clip_R1 <int>- Instructs Trim Galore to remove
<int>bp from the 3' end of read 1 (or single-end reads) AFTER adapter/quality trimming has been performed. This may remove some unwanted bias from the 3' end that is not directly related to adapter sequence or basecall quality. - Default:
OFF
- Instructs Trim Galore to remove
-
--three_prime_clip_R2 <int>- Instructs Trim Galore to re move
<int>bp from the 3' end of read 2 AFTER adapter/quality trimming has been performed. This may remove some unwanted bias from the 3' end that is not directly related to adapter sequence or basecall quality. - Default:
OFF
- Instructs Trim Galore to re move
-
--2colour/--nextseq INT- This enables the option
--nextseq-trim=3'CUTOFFwithin Cutadapt, which will set a quality cutoff (that is normally given with -q instead), but qualities of G bases are ignored. This trimming is in common for the NextSeq- and NovaSeq-platforms, where basecalls without any signal are called as high-quality G bases. More on the issue of G-overcalling may be found here: https://sequencing.qcfail.com/articles/illumina-2-colour-chemistry-can-overcall-high-confidence-g-bases/. This is mutually exlusive with-q INT.
- This enables the option
-
--path_to_cutadapt </path/to/cutadapt>- You may use this option to specify a path to the Cutadapt executable, e.g.
/my/home/cutadapt-1.7.1/bin/cutadapt. Else it is assumed that Cutadapt is in thePATH.
- You may use this option to specify a path to the Cutadapt executable, e.g.
-
--basename <PREFERRED_NAME>- Use PREFERRED_NAME as the basename for output files, instead of deriving the filenames from the input files. Single-end data would be called
PREFERRED_NAME_trimmed.fq(.gz), orPREFERRED_NAME_val_1.fq(.gz)andPREFERRED_NAME_val_2.fq(.gz)for paired-end data.--basenameonly works when 1 file (single-end) or 2 files (paired-end) are specified, but not for longer lists.
- Use PREFERRED_NAME as the basename for output files, instead of deriving the filenames from the input files. Single-end data would be called
-
-j/--cores INT-
Number of cores to be used for trimming [default: 1]. For Cutadapt to work with multiple cores, it requires Python 3 as well as parallel gzip (
pigz) installed on the system. Trim Galore attempts to detect the version of Python used by calling Cutadapt. If Python 2 is detected, –cores is set to 1. If the Python version cannot be detected, Python 3 is assumed and we let Cutadapt handle potential issues itself. -
If
pigzcannot be detected on your system, Trim Galore reverts to usinggzipcompression. Please note thatgzipcompression will slow down multi-core processes so much that it is hardly worthwhile, please see: https://github.com/FelixKrueger/TrimGalore/issues/16#issuecomment-458557103 for more info). -
Actual core usage: It should be mentioned that the actual number of cores used is a little convoluted. Assuming that Python 3 is used and pigz is installed,
--cores 2would use 2 cores to read the input (probably not at a high usage though), 2 cores to write to the output (at moderately high usage), and 2 cores for Cutadapt itself + 2 additional cores for Cutadapt (not sure what they are used for) + 1 core for Trim Galore itself. So this can be up to 9 cores, even though most of them won’t be used at 100% for most of the time. Paired-end processing uses twice as many cores for the validation (= writing out) step.--cores 4would then be: 4 (read) + 4 (write) + 4 (Cutadapt) + 2 (extra Cutadapt) + 1 (Trim Galore) = 15, and so forth. -
It seems that
--cores 4could be a sweet spot, anything above has diminishing returns.
-
SPECIFIC TRIMMING - without adapter/quality trimming
-
--hardtrim5 <int>- Instead of performing adapter-/quality trimming, this option will simply hard-trim sequences to
bp from the 3'-end. Once hard-trimming of files is complete, Trim Galore will exit. Hard-trimmed output files will end in .<int>bp_5prime.fq(.gz).
- Instead of performing adapter-/quality trimming, this option will simply hard-trim sequences to
-
--hardtrim3 <int>- Instead of performing adapter-/quality trimming, this option will simply hard-trim sequences to
bp from the 5'-end. Once hard-trimming of files is complete, Trim Galore will exit. Hard-trimmed output files will end in .<int>bp_3prime.fq(.gz).
- Instead of performing adapter-/quality trimming, this option will simply hard-trim sequences to
-
--clock- In this mode, reads are trimmed in a specific way that is currently used for the Mouse Epigenetic Clock (see here: Multi-tissue DNA methylation age predictor in mouse, Stubbs et al., Genome Biology, 2017 18:68 https://doi.org/10.1186/s13059-017-1203-5). Following this, Trim Galore will exit.
In it’s current implementation, the dual-UMI RRBS reads come in the following format:
1 2Read 1 5' UUUUUUUU CAGTA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF TACTG UUUUUUUU 3' Read 2 3' UUUUUUUU GTCAT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF ATGAC UUUUUUUU 5'Where UUUUUUUU is a random 8-mer unique molecular identifier (UMI), CAGTA is a constant region and FFFFFFF… is the actual RRBS-Fragment to be sequenced. The UMIs for Read 1 (R1) and Read 2 (R2), as well as the fixed sequences (F1 or F2), are written into the read ID and removed from the actual sequence. Here is an example:
1 2 3 4 5 6 7 8 9R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT ATCTAGTTCAGTACGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTG R2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT CAATTTTGCAGTACAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAA R1: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 1:N:0: CGATGTTT:R1:ATCTAGTT:R2:CAATTTTG:F1:CAGT:F2:CAGT CGGTGTTTTCGAATTAGAAAAATATGTATAGAGGAAATAGATATAAAGGCGTATTCGTTATTG R2: @HWI-D00436:407:CCAETANXX:1:1101:4105:1905 3:N:0: CGATGTTT:R1:ATCTAGTT:R2:CAATTTTG:F1:CAGT:F2:CAGT CAAAAATAATACCTCCTCTATTTATCCAAAATCACAAAAAACCACCCACTTAACTTTCCCTAAFollowing clock trimming, the resulting files (.clock_UMI.R1.fq(.gz) and .clock_UMI.R2.fq(.gz)) should be adapter- and quality trimmed with Trim Galore as usual. In addition, reads need to be trimmed by 15bp from their 3' end to get rid of potential UMI and fixed sequences. The command is:
1trim_galore --paired --three_prime_clip_R1 15 --three_prime_clip_R2 15 *.clock_UMI.R1.fq.gz *.clock_UMI.R2.fq.gzFollowing this, reads should be aligned with Bismark and deduplicated with UmiBam in
--dual_indexmode (see here: https://github.com/FelixKrueger/Umi-Grinder). UmiBam recognises the UMIs within this pattern: R1:(ATCTAGTT):R2:(CAATTTTG): as (UMI R1=ATCTAGTT) and (UMI R2=CAATTTTG).
RRBS-specific options (MspI digested material):
-
--rrbs- Specifies that the input file was an MspI digested RRBS sample (recognition site:
CCGG). Sequences which were adapter-trimmed will have a further 2 bp removed from their 3' end. This is to avoid that the filled-in C close to the second MspI site in a sequence is used for methylation calls. Sequences which were merely trimmed because of poor quality will not be shortened further.
- Specifies that the input file was an MspI digested RRBS sample (recognition site:
-
--non_directional- Selecting this option for non-directional RRBS libraries will screen quality-trimmed sequences for
CAAorCGAat the start of the read and, if found, removes the first two base pairs. Like with the option--rrbsthis avoids using cytosine positions that were filled-in during the end-repair step.--non_directionalrequires--rrbsto be specified as well.
- Selecting this option for non-directional RRBS libraries will screen quality-trimmed sequences for
-
--keep- Keep the quality trimmed intermediate file. If not specified the temporary file will be deleted after adapter trimming. Only has an effect for RRBS samples since other FastQ files are not trimmed for poor qualities separately.
- Default:
OFF
Note for RRBS using MseI:
If your DNA material was digested with MseI (recognition motif: TTAA) instead of MspI it is NOT necessary to specify --rrbs or --non_directional since virtually all reads should start with the sequence TAA, and this holds true for both directional and non-directional libraries. As the end-repair of TAA restricted sites does not involve any cytosines it does not need to be treated especially. Instead, simply run Trim Galore! in the standard, i.e. non-RRBS, mode.
Paired-end specific options:
--paired- This option performs length trimming of quality/adapter/RRBS trimmed reads for paired-end files. To pass the validation test, both sequences of a sequence pair are required to have a certain minimum length which is governed by the option
--length(see above). If only one read passes this length threshold the other read can be rescued (see option--retain_unpaired). - Using this option lets you discard too short read pairs without disturbing the sequence-by-sequence order of FastQ files which is required by many aligners.
Trim Galore! expects paired-end files to be supplied in a pairwise fashion, e.g.
file1_1.fqfile1_2.fqSRR2_1.fq.gzSRR2_2.fq.gz....
- This option performs length trimming of quality/adapter/RRBS trimmed reads for paired-end files. To pass the validation test, both sequences of a sequence pair are required to have a certain minimum length which is governed by the option
-t/--trim1- Trims 1 bp off every read from its 3' end.
- This may be needed for FastQ files that are to be aligned as paired-end data with Bowtie 1. This is because Bowtie (1) regards alignments like this as invalid (whenever a start/end coordinate is contained within the other read):
|
|
--retain_unpaired- If only one of the two paired-end reads became too short, the longer read will be written to either
.unpaired_1.fqor.unpaired_2.fqoutput files. The length cutoff for unpaired single-end reads is governed by the parameters-r1/--length_1and-r2/--length_2. - Default:
OFF.
- If only one of the two paired-end reads became too short, the longer read will be written to either
-r1/--length_1 <INT>- Unpaired single-end read length cutoff needed for read 1 to be written to
.unpaired_1.fqoutput file. These reads may be mapped in single-end mode. - Default:
35 bp
- Unpaired single-end read length cutoff needed for read 1 to be written to
-r2/--length_2 <INT>- Unpaired single-end read length cutoff needed for read 2 to be written to
.unpaired_2.fqoutput file. These reads may be mapped in single-end mode. - Default:
35 bp
- Unpaired single-end read length cutoff needed for read 2 to be written to
Location and version
|
|
help message
|
|
software ref: https://github.com/FelixKrueger/TrimGalore
research ref: <>